View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4985_low_6 (Length: 285)

Name: NF4985_low_6
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4985_low_6
NF4985_low_6
[»] chr3 (1 HSPs)
chr3 (35-222)||(45987247-45987434)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 45987434 - 45987247
Alignment:
35 aagctgagcgccacgtacgaagtgacgctttgctttgattgcttttcggttttggaatcggagttttgcgaggaatttttgaggaattccgtgcatgctg 134  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45987434 aagctgagcgccacgtacgaagtgccgctttgctttgattgcttttcggttttggaatcggagttttgcgaggaatttttgaggaattccgtgcatgctg 45987335  T
135 aggaagattaaagccattgcgaggatcatgatgacttgtaaaccgatgtcgcggtacatcgcttgtttctctgtaatctccattttct 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45987334 aggaagattaaagccattgcgaggatcatgatgacttgtaaaccgatgtcgcggtacatcgcttgtttctctgtaatctccattttct 45987247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University