View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4985_low_6 (Length: 285)
Name: NF4985_low_6
Description: NF4985
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4985_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 35 - 222
Target Start/End: Complemental strand, 45987434 - 45987247
Alignment:
| Q |
35 |
aagctgagcgccacgtacgaagtgacgctttgctttgattgcttttcggttttggaatcggagttttgcgaggaatttttgaggaattccgtgcatgctg |
134 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45987434 |
aagctgagcgccacgtacgaagtgccgctttgctttgattgcttttcggttttggaatcggagttttgcgaggaatttttgaggaattccgtgcatgctg |
45987335 |
T |
|
| Q |
135 |
aggaagattaaagccattgcgaggatcatgatgacttgtaaaccgatgtcgcggtacatcgcttgtttctctgtaatctccattttct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45987334 |
aggaagattaaagccattgcgaggatcatgatgacttgtaaaccgatgtcgcggtacatcgcttgtttctctgtaatctccattttct |
45987247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University