View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4986-Insertion-4 (Length: 197)
Name: NF4986-Insertion-4
Description: NF4986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4986-Insertion-4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 3e-50; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 3243053 - 3242949
Alignment:
| Q |
8 |
caaccatggatagccattcaagaaaaagctgtctgagtacatctgagaatcacacttagagaagttcttaatcgaccatgtgaattgctcaatcgtccat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3243053 |
caaccatggatagccattcaagaaaaagctgtctgagtacatctgagaatcacacttagagaagttcttaatcgtccatgtgaattgctcaatcgtccat |
3242954 |
T |
|
| Q |
108 |
gggga |
112 |
Q |
| |
|
||||| |
|
|
| T |
3242953 |
gggga |
3242949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 3242966 - 3242903
Alignment:
| Q |
134 |
ctcaatcgtccatggggaccatggggatatattctccatctcagcagcctaacagcttcaactc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3242966 |
ctcaatcgtccatggggaccatggggatatgttctccatctcagcagcctaacagcttcaactc |
3242903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 39 - 132
Target Start/End: Complemental strand, 3238887 - 3238794
Alignment:
| Q |
39 |
tctgagtacatctgagaatcacacttagagaagttcttaatcgaccatgtgaattgctcaatcgtccatggggatatattctcaaatgctttac |
132 |
Q |
| |
|
||||||||| ||| ||||||||| || |||||||| ||||||| ||||||||||||||||||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
3238887 |
tctgagtacgtcttagaatcacatttggagaagttattaatcgtccatgtgaattgctcaatcgtccctggggatttcttctcaattgctttac |
3238794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University