View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4986_high_6 (Length: 241)
Name: NF4986_high_6
Description: NF4986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4986_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 6e-21; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 24704301 - 24704181
Alignment:
| Q |
1 |
aaagaacattta-ttctgattacagttcaannnnnnngaatcctatctttttgaactactatttat---actctaagatcaccccttat---gtatattt |
93 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||| ||| |||||||| |
|
|
| T |
24704301 |
aaagaacatttaattctgatgacagttcaatttttttgaatcctatctttttgaactactatttatcctactctaagatccccccatatagagtatattt |
24704202 |
T |
|
| Q |
94 |
gaatccccctaaactcccttg |
114 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24704201 |
gaatccccctaaactcccttg |
24704181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 154 - 224
Target Start/End: Complemental strand, 24634536 - 24634466
Alignment:
| Q |
154 |
acacaaaatgagtatccataaaacatatatgattcttatgagtttgcagttgggttcaattggaattatgt |
224 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24634536 |
acacaaaatgagtatccataaagcatatactattctgatgagtttggagttgggttcaattggaattatgt |
24634466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 163
Target Start/End: Complemental strand, 24704159 - 24704126
Alignment:
| Q |
130 |
atcttcccccgatcagcacaaacaacacaaaatg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
24704159 |
atcttcccccgatcagcacaaacaacacaaaatg |
24704126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 154 - 217
Target Start/End: Complemental strand, 24656640 - 24656577
Alignment:
| Q |
154 |
acacaaaatgagtatccataaaacatatatgattcttatgagtttgcagttgggttcaattgga |
217 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
24656640 |
acacaaaatgagtatgcataaagcatatactattcttatgaccttagagttgggttcaattgga |
24656577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 155 - 224
Target Start/End: Complemental strand, 24680206 - 24680137
Alignment:
| Q |
155 |
cacaaaatgagtatccataaaacatatatgattcttatgagtttgcagttgggttcaattggaattatgt |
224 |
Q |
| |
|
|||||||||||| || ||||| |||||| ||||| ||||| ||| ||||| | |||||||||||||||| |
|
|
| T |
24680206 |
cacaaaatgagtttctataaagcatatactattctcatgagcttggagttgagctcaattggaattatgt |
24680137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University