View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4986_low_10 (Length: 272)
Name: NF4986_low_10
Description: NF4986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4986_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 159 - 267
Target Start/End: Complemental strand, 26610164 - 26610056
Alignment:
| Q |
159 |
ggattggaaccgcaagagcaattttaccaaattattatgttgtttatgttttacattttgtgtcacattgaaaccacttatttggtttggtatacttagg |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26610164 |
ggattggaaccgcaagagcaattttaccaaattattatattgtttatgttttagactttgtgtcacattgaaaccacttatttggttttgtatacttagg |
26610065 |
T |
|
| Q |
259 |
tctcttgtt |
267 |
Q |
| |
|
||||||||| |
|
|
| T |
26610064 |
tctcttgtt |
26610056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 34899936 - 34899975
Alignment:
| Q |
1 |
tataggtaaagtttggtagtttcaactttcaagttgagat |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899936 |
tataggtaaagtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University