View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4986_low_5 (Length: 312)
Name: NF4986_low_5
Description: NF4986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4986_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 124 - 305
Target Start/End: Complemental strand, 4421549 - 4421367
Alignment:
| Q |
124 |
gttgcttgcgttagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgata-tctgtggttaagtcgtcattttcgtaag |
222 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4421549 |
gttgtttgcattagtatattatttcttttagctcaagaaatttcaccagggtcaaagttttttaaatgataatctgtggttaagtcgtcattttcgtaag |
4421450 |
T |
|
| Q |
223 |
atataaacaactttatagtagtagtttaaccattcattcgtctctttattttttggcaaactgtcaagtaatttcagtataat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
4421449 |
atataaacaactttatagtagtagtttaaccattcattcgtctctttattttttggcaaactctcaagtaatttcagtgtaat |
4421367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 18 - 91
Target Start/End: Complemental strand, 4421650 - 4421582
Alignment:
| Q |
18 |
catatgtgagtgcttcggaaactatgattacatgcataggataggaagccaggattagccgaaatagtaatctc |
91 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
4421650 |
catatgtgagtgcttcgaaaactaggattacatgcat-----aggaagccaggattagccgaactagtaatctc |
4421582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University