View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4987_high_17 (Length: 305)
Name: NF4987_high_17
Description: NF4987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4987_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 21 - 261
Target Start/End: Original strand, 12544800 - 12545040
Alignment:
| Q |
21 |
tgtgcttggctgaatgataccatcttggagcatttcagtgattaatttggttatggcttctttttgatagtgaggatagcggtaaggtttgatattaatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12544800 |
tgtgcttggctgaatgataccatcttggagcatttcagtgattagtttggtcatggcttctttttgatagtggggatagcggtaaggtttgatattaatg |
12544899 |
T |
|
| Q |
121 |
ggggaagctgtggggttgagatgaatatggtggtcatgtggtcttggtggtggtaaagtgtttggttttgaaaatatttgtagatggtgatggagtatgg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12544900 |
ggggaagctgtggggttgagatgaatatggtggtcatgtggtcttggtggtggtaaagtgtttggttttgaaaatatttgtagatggtgatggagtatgg |
12544999 |
T |
|
| Q |
221 |
gttgtatgtcagggtggaaggtaaggaagagttggtcatca |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12545000 |
gttgtatgtcagggtggaaggtaaggaagagttggtcatca |
12545040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University