View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4987_high_8 (Length: 350)
Name: NF4987_high_8
Description: NF4987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4987_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 7e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 209 - 282
Target Start/End: Complemental strand, 30733437 - 30733364
Alignment:
| Q |
209 |
tagagtcagacacttagctaaatccgcacgcaaaaggaatgtggttctggttgaggctttctttcctttattag |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30733437 |
tagagtcagacacttagctaaatccgcacgcaaaaggaatgtggttctggttgaggctttctttcctttattag |
30733364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University