View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4987_high_9 (Length: 347)
Name: NF4987_high_9
Description: NF4987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4987_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 40 - 306
Target Start/End: Complemental strand, 43151423 - 43151157
Alignment:
| Q |
40 |
tggagttgaagaatatgtgacgtatggttccagaattatgccgctgccaaatcacccacacttcaacataaagagaagaacacaaagcatcttattactc |
139 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43151423 |
tggagttgaagaatctgtgacgtatggttccagaattatgccgctgccaaatcacccacacttcaacataaagagaagaacacaaagcatcttattactc |
43151324 |
T |
|
| Q |
140 |
acttatttggatgctatgtttttcctggaagattttatcacttgtacatctttccataattttggtgggggccacaaacagaatctaactttcctgtggg |
239 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43151323 |
acttattgggatgctatgtttttcctggaagattttatcacttgtacatctttccataattttggtgggggccacaaacagaatctaactttcctgtggg |
43151224 |
T |
|
| Q |
240 |
gtgggtggtgcatcgtcacttcgtcatgcctctctacgagggatgttgaatttctttgttggacact |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43151223 |
gtgggtggtgcatcgtcacttcgtcatgcctctctacgagggatgttgaatttctttgttggacact |
43151157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University