View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4989_high_13 (Length: 280)
Name: NF4989_high_13
Description: NF4989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4989_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 61 - 269
Target Start/End: Original strand, 2273644 - 2273852
Alignment:
| Q |
61 |
cacctagtatatcttaacctaaatttaaggtttttcttctctcaaacttgtctcaaattctcaatcatttaaatagataatgtgaattcaaaactcttaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2273644 |
cacctagtatatcttaacctaaatttaaggtttttcttctctcaaacttgtctcaaattctcaatcatttaaatagataatgtgaattcaaaactcttaa |
2273743 |
T |
 |
| Q |
161 |
gtaaaatgaagactaacccgaaataaccaannnnnnnnnnnatgtaattcctatgattttatgggaaggaagttcgggtaatctggagttcagttgtgaa |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2273744 |
gtaaaatgaagactaacccgaaataaccaatttttttttttatgtaattcctatggttttatgggaaggaagttcggataatctggagttcagttgtgaa |
2273843 |
T |
 |
| Q |
261 |
gtaagtata |
269 |
Q |
| |
|
||||||||| |
|
|
| T |
2273844 |
gtaagtata |
2273852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University