View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4989_low_16 (Length: 278)
Name: NF4989_low_16
Description: NF4989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4989_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 2 - 262
Target Start/End: Complemental strand, 15568676 - 15568416
Alignment:
| Q |
2 |
catccaataaaagaagtcatgggtaacatagcataatgttttgcagctataaaatatatgnnnnnnnnnaagcaaactattttatgagttgaggaactta |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
15568676 |
catccaataaaagaagtcatgggtaacatagcataatgttttgcagctataaaatatatgtttttttttaagcaaactattttatgagttgaggaactta |
15568577 |
T |
 |
| Q |
102 |
atcatgatgcgtnnnnnnncgaacttaattattatggtaaatttatttaggaaagttctgagattcgaaagactagtctctacggctacgtgcgtagaga |
201 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
15568576 |
atcatgatgcgtaaaaaaacgaacttaattattatggtaaatgtatttaggaaatttctgagattcgagagactagtctctacggctacttgcgtagaga |
15568477 |
T |
 |
| Q |
202 |
atacggaaaatgcttgggtgacattggcacccaatatcacccaagtcctatcctagagaat |
262 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15568476 |
atacggaaaatgcttgagtgacattggcacccaatatcacccaagtcctatcctagagaat |
15568416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University