View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4989_low_27 (Length: 236)
Name: NF4989_low_27
Description: NF4989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4989_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 41479956 - 41480018
Alignment:
| Q |
1 |
ttttatcctctgtcgtctcttccacttagactcatgtagtttcagtttgcctttccgtttttg |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41479956 |
ttttatcctctgtcgtctcttccacttagactcatgtagtttcagtttgcctttccgtttttg |
41480018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 1e-21; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 24084553 - 24084617
Alignment:
| Q |
155 |
tagtccatcctcaacttcaagtatctcattctcttccacttcatctccatatccaactatctctt |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24084553 |
tagttcatcctcaacttcaagtatctcattctcttccatttcatctccatctccaactatctctt |
24084617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 136
Target Start/End: Original strand, 24084511 - 24084564
Alignment:
| Q |
82 |
aaataaagacataagtcataactaagaaatccaaactactttctggttcatcctc |
136 |
Q |
| |
|
||||||||||||||| ||||||| | |||||| ||||||||||| |||||||||| |
|
|
| T |
24084511 |
aaataaagacataag-cataactcataaatcctaactactttctagttcatcctc |
24084564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University