View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4989_low_7 (Length: 380)
Name: NF4989_low_7
Description: NF4989
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4989_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 20 - 368
Target Start/End: Original strand, 50538291 - 50538639
Alignment:
| Q |
20 |
ctgctaaccttgggatcatgtctgatccttctggtttccaagaacaggtccaccaacatcacaacacaactagcggtgttgttggtagttctgttcttgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
50538291 |
ctgctaaccttgggatcatgtctgatccttctggtttccaagaacaggtccaccaacatcacaacacaactagcggcgttgttggtagttctgttcttgg |
50538390 |
T |
|
| Q |
120 |
aaacgaatttgcgatgtctcaatcacaacaatatcaaaaatttcaggatcagaatcagaatgtgcttcatcagcagcggcaagcagtgccatctttgtta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50538391 |
aaacgaatttgcgatgtctcaatcacaacaatatcaaaaatttcaggatcagaatcagaatgtgcttcatcaccagcggcaagcagtgccatctttgtta |
50538490 |
T |
|
| Q |
220 |
tataatagtgattataacaactccttcaacatttctccacttttgaatgttgttaactctgctgataatttgatgatctcttcagcatcttttggtggat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50538491 |
tataatagtgattataacaactccttcaacatttctccactttcgaatattgttaactctgctgataatttgatgatctcttcaacatcttttggtggat |
50538590 |
T |
|
| Q |
320 |
ttcttcaaaatcaagaaaattatggtggaggcaattcttctgtgtcttc |
368 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50538591 |
ttcttcaaaatcaagaaaattatggtggaggcaattcttctctgtcttc |
50538639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University