View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4990_low_13 (Length: 276)
Name: NF4990_low_13
Description: NF4990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4990_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 256
Target Start/End: Complemental strand, 40448659 - 40448414
Alignment:
| Q |
13 |
aatatgccgaaaaaagttgccatttcattacttcctaatgttggtgctgtttatttatat------acaggcaaacgaaataacttattcttttcaatac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| || |
|
|
| T |
40448659 |
aatatgccgaaaaaagttgccatttcattacttcctaatgttggtgctgtttatttatatttatatacaggcaaacgaaataacttaatcttttcaagac |
40448560 |
T |
|
| Q |
107 |
tagactgtgctattcagctagagccaggggaggtaataaatttcattttcacttagaatgtatcaattgcatatatagtattttcttaatatcaaatcat |
206 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40448559 |
tagattgtgctattcagctagagccaggggaggtaataaatttcattttcacttagaatgtatcaattgc----atagtattttcttaatatcaaatcat |
40448464 |
T |
|
| Q |
207 |
atgaccaatttttcatttctttcagcatcattgattcttggcttgcttgc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40448463 |
atgaccaatttttcatttctttcagcatcattgattcttggcttgcttgc |
40448414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University