View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4990_low_17 (Length: 232)
Name: NF4990_low_17
Description: NF4990
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4990_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 36283954 - 36284165
Alignment:
| Q |
1 |
aacatgaaaatagatgaaagtttagatggagagagtattacattggagtccacactatcagaaactcatgcaccaattgcaattcatgaaactgtccaaa |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36283954 |
aacatgaaaatagatgaaaatttagatggagagagtattacattggagtccacactatcagaaactcatgcaccaattgcaattcatgaaactatccaaa |
36284053 |
T |
|
| Q |
101 |
gagagacagagaatcagcaagattcaaaaacaagcataacaaaaggcaaaaccaccaacgtagtcccattttacaaactcttctcttttgcagactctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36284054 |
gagagacagagaatcagcaagattcaaaaacaagcataacaaaaggcaaaaccaccaacgtagtcccattttacaaactcttctcttttgcagactctct |
36284153 |
T |
|
| Q |
201 |
tgatcatgtatt |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
36284154 |
tgatcatgtatt |
36284165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University