View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4991-Insertion-2 (Length: 337)
Name: NF4991-Insertion-2
Description: NF4991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4991-Insertion-2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 39 - 337
Target Start/End: Original strand, 21078099 - 21078397
Alignment:
| Q |
39 |
gatgagcagaaaaagaatattggttgtttaatatcaacaatgttcaaatgtgatttgtgccacagaatcttcacctccggcactgcactcggtggccaca |
138 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21078099 |
gatgatcagaaaaagaatattggttgttcaatatcaacaatgttcaaatgtgatttgtgccacagaatcttcacctccggcactgcactcggcggccaca |
21078198 |
T |
|
| Q |
139 |
aatcacatcaccaccgctctgatcaccttgttcaacaacctctgaccaagaaacataaacatgatgttcttgatgatcataggaagcagaagcatgcttt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
21078199 |
aatcacatcaccaccgctctgatcaccttgttcaacaacctctgaccaagaaacagaaacatgatgttcttgatgatcataggaagcagaagcatgcatt |
21078298 |
T |
|
| Q |
239 |
tcttgaccatgataaggtttttccttccaacatgagatcgcaccgcgaaaagggtattgagtctccaaccacatccttcttccctgtctccttcttgga |
337 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21078299 |
tcttgactatgataaggtttttccgtccaacatgagatcgcactgcgaaaagggtattgagtctccgaccacatccttcttccctgtctccttcttgga |
21078397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University