View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4991_low_3 (Length: 243)
Name: NF4991_low_3
Description: NF4991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4991_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 15 - 146
Target Start/End: Complemental strand, 14472438 - 14472307
Alignment:
| Q |
15 |
tagcatagggatagggagtcgaagtcttaatagacaggaacccaactatacaagggatggtgtgattgctaaaatttgaaagtatctcatgaatgtttga |
114 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14472438 |
tagcatagggatagggactcgaagtcttaatagacaggaaccctactatacaagggatggtgtgattgctaaaatttgaaagtatctcatgaatgcttga |
14472339 |
T |
 |
| Q |
115 |
cattgaactccattatttaagcatttatttta |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
14472338 |
cattgaactccattatttaagcatttatttta |
14472307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University