View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4991_low_3 (Length: 243)

Name: NF4991_low_3
Description: NF4991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4991_low_3
NF4991_low_3
[»] chr2 (1 HSPs)
chr2 (15-146)||(14472307-14472438)


Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 15 - 146
Target Start/End: Complemental strand, 14472438 - 14472307
Alignment:
15 tagcatagggatagggagtcgaagtcttaatagacaggaacccaactatacaagggatggtgtgattgctaaaatttgaaagtatctcatgaatgtttga 114  Q
    ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
14472438 tagcatagggatagggactcgaagtcttaatagacaggaaccctactatacaagggatggtgtgattgctaaaatttgaaagtatctcatgaatgcttga 14472339  T
115 cattgaactccattatttaagcatttatttta 146  Q
    ||||||||||||||||||||||||||||||||    
14472338 cattgaactccattatttaagcatttatttta 14472307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University