View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4993-Insertion-5 (Length: 185)
Name: NF4993-Insertion-5
Description: NF4993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4993-Insertion-5 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 38924570 - 38924748
Alignment:
| Q |
7 |
aagattaaattgattgatttaataaccaattttcagagagatatcaaacactcgctagacctagccccaccctgcaatgctagaaaagaggaaaacaaac |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38924570 |
aagattaaattgattgattttataaccaattttcagagagatatcaaacactcgctagacctagccccaccctgtaatgctagaaaagaggaaaacaaac |
38924669 |
T |
|
| Q |
107 |
taaccaaatatgtacgtaacactaaaacacatcctaaccattagtaacaaaaggatgatatatcatgacgacgccattt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38924670 |
taaccaaatatgtacgtaacactaaaacacatcctaaccattagtaacaaaaggatgatatatcatgacgactccattt |
38924748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University