View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4993_high_10 (Length: 247)

Name: NF4993_high_10
Description: NF4993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4993_high_10
NF4993_high_10
[»] chr8 (1 HSPs)
chr8 (103-170)||(3607690-3607757)


Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 103 - 170
Target Start/End: Original strand, 3607690 - 3607757
Alignment:
103 gacgtaggaacttcaaattcattacttgttttgctgattgtttattttcaccagcccagcatactctc 170  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3607690 gacgtaggaacttcaaattcattacttgttttgctgattgtttattttcaccagcccagcatactctc 3607757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University