View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4993_high_11 (Length: 217)
Name: NF4993_high_11
Description: NF4993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4993_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 104 - 202
Target Start/End: Original strand, 40705850 - 40705949
Alignment:
| Q |
104 |
ctgctctgagagcattgtgatgcatctatcattaggtca-ctaaataaaattcatggacttcaattatatgtgttataaaccttgtctttgaaattcttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40705850 |
ctgctctgagagcattgtgatgcatctatcattaggtcatctaaataaaattcatggacttcaattatatgtgttataaaccttgtctttgaaattcttc |
40705949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40676732 - 40676676
Alignment:
| Q |
105 |
tgctctgagagcattgtgatgcatctatcattaggtca-ctaaataaaattcatgga |
160 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| | |||||||||||||||| |
|
|
| T |
40676732 |
tgctctgagagcattgtgatgtctctttcattaggtcatcaaaataaaattcatgga |
40676676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University