View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4993_high_11 (Length: 217)

Name: NF4993_high_11
Description: NF4993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4993_high_11
NF4993_high_11
[»] chr1 (2 HSPs)
chr1 (104-202)||(40705850-40705949)
chr1 (105-160)||(40676676-40676732)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 104 - 202
Target Start/End: Original strand, 40705850 - 40705949
Alignment:
104 ctgctctgagagcattgtgatgcatctatcattaggtca-ctaaataaaattcatggacttcaattatatgtgttataaaccttgtctttgaaattcttc 202  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40705850 ctgctctgagagcattgtgatgcatctatcattaggtcatctaaataaaattcatggacttcaattatatgtgttataaaccttgtctttgaaattcttc 40705949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 160
Target Start/End: Complemental strand, 40676732 - 40676676
Alignment:
105 tgctctgagagcattgtgatgcatctatcattaggtca-ctaaataaaattcatgga 160  Q
    |||||||||||||||||||||  ||| ||||||||||| | ||||||||||||||||    
40676732 tgctctgagagcattgtgatgtctctttcattaggtcatcaaaataaaattcatgga 40676676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University