View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4993_low_13 (Length: 247)
Name: NF4993_low_13
Description: NF4993
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4993_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 103 - 170
Target Start/End: Original strand, 3607690 - 3607757
Alignment:
| Q |
103 |
gacgtaggaacttcaaattcattacttgttttgctgattgtttattttcaccagcccagcatactctc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3607690 |
gacgtaggaacttcaaattcattacttgttttgctgattgtttattttcaccagcccagcatactctc |
3607757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University