View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4994_high_9 (Length: 236)
Name: NF4994_high_9
Description: NF4994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4994_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 55938988 - 55938769
Alignment:
| Q |
1 |
taacattttgtaatactgccatatagataaattatctaatatttttagtctctctatggaatttttaatgattnnnnnnnnggaatgagaatcggcagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
55938988 |
taacattttgtaatactgccatatagataaattattttatatttttagtctctctatggaatttttaatgattaaaaaaa-ggaatgagaatcggcagct |
55938890 |
T |
 |
| Q |
101 |
aaggtgaaaagtccaaaaggaagaagttgattgggcaaatctaacagattataattagtactttgtggggtattcattgattgcatgagcatatatgtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55938889 |
aaggtgaaaagtccaaaaggaagaagttgattgggcaaatctaacagattataattagtactttgtggggtattcattgattgcataagcatatatgtcc |
55938790 |
T |
 |
| Q |
201 |
tgtttttatttcggtacaaag |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55938789 |
tgtttttatttcggtacaaag |
55938769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 138
Target Start/End: Complemental strand, 9587305 - 9587249
Alignment:
| Q |
82 |
ggaatgagaatcggcagctaaggtgaaaagtccaaaaggaagaagttgattgggcaa |
138 |
Q |
| |
|
||||||||||||||||| || | || ||||||||||| ||||| ||||||||||||| |
|
|
| T |
9587305 |
ggaatgagaatcggcaggtaggatgcaaagtccaaaaagaagatgttgattgggcaa |
9587249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University