View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4994_low_1 (Length: 512)
Name: NF4994_low_1
Description: NF4994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4994_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 2e-38; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 6922859 - 6922765
Alignment:
| Q |
18 |
ctcactaccctcacaaaaataatcaatcatagctcccttttcaattctaaattctcaatcttttatcaaaataacgtaaccccatcaatttcttctctc |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6922859 |
ctcactaccctcacaaaaataatca----tagctcccttttcaattctaaattctcaatcttttatcaaaataacgtaaccccatcaatttcttctctc |
6922765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 444 - 503
Target Start/End: Complemental strand, 6922440 - 6922381
Alignment:
| Q |
444 |
acaatgtaatgccagcttcatttcctcagtatgtcactgaggctattactggtcctatgc |
503 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6922440 |
acaatgtaatgccagcttcatttcctcagtatgtcactgaggctattactggtcctatgc |
6922381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 6922716 - 6922668
Alignment:
| Q |
165 |
caacaaattctgggtttgaatcgattttttgaaccatggctttgatccg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6922716 |
caacaaattctgggtttgaatcgattttttgaaccatggctttgatccg |
6922668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University