View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4994_low_4 (Length: 382)
Name: NF4994_low_4
Description: NF4994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4994_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 18 - 375
Target Start/End: Complemental strand, 29116682 - 29116323
Alignment:
| Q |
18 |
gctttgtgttgcaaaggtatcttcgatgatccaataagtcttttgtattgagttggatccacttctctctcttttatttcatttcatagttttggtcttg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
| T |
29116682 |
gctttgtgttgcaaaggtatcttcgatgatccaatgagtcttttgtattgagttggatccacttctttctcttttatttcttttgatagttttggtcttg |
29116583 |
T |
|
| Q |
118 |
gttcaatgggggttacatcaagatttcaatactccatctaaaaccttttaagaatttcactagcatat--ctcttttgatgaattagaagccctacttgt |
215 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29116582 |
gttcaataggggttacatcaagattgcaatattccatctaaaaccttttaagaatttcactagcatatatctcttttgatgaattagaagccctacttgt |
29116483 |
T |
|
| Q |
216 |
tctttgaaactccatggcaaggaaatatgagatgtgaagtagatcaaccatctcaaattccttcatcaaatcattcttaaagtcgtttatgtaagatcca |
315 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29116482 |
tctttgaaactccatgcgaaggaaatatgaaatgtgacctagatcaaccatctcaaattccttcatcaaatcattcttaaattcgtttatgtaagatcca |
29116383 |
T |
|
| Q |
316 |
ttgctacatgtgataagaaaatcatttacataaagatatagaatgattacccctttgctt |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29116382 |
ttgctacatgtgataagaaaatcatttacataaagatatagaatgattacccctttgctt |
29116323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University