View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4995-Insertion-8 (Length: 236)
Name: NF4995-Insertion-8
Description: NF4995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4995-Insertion-8 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 54791336 - 54791108
Alignment:
| Q |
8 |
atccaatggtctgtacttggcaaattcctttagccagtatccagcatcgttaaagttgctcttaatgttaacgattatgcctgtccatggccagacataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54791336 |
atccaatggtctgtacttggcaaattcctttagccagtatccagaatcgttaaagttgctcttaatgttaacgattatgcctgtccatggccagacataa |
54791237 |
T |
|
| Q |
108 |
ttctcaacctgcggtgcaggttggttgacagcttcggccaaagccgggggaggtatttggtctgcttcatttactaggtcagtctccaaatactttgcca |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54791236 |
ttctcaacctgcggtacaggttggttgacagcttcggccaaagccgggggaggtatttggtctgcttcatttactaggtcggtctccaaatactttgcca |
54791137 |
T |
|
| Q |
208 |
gagcgaggtggtttgccttttgtttggcg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54791136 |
gagcgaggtggtttgccttttgtttggcg |
54791108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 8 - 236
Target Start/End: Original strand, 54777810 - 54778037
Alignment:
| Q |
8 |
atccaatggtctgtacttggcaaattcctttagccagtatccagcatcgttaaagttgctcttaatgttaacgattatgcctgtccatggccagacataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
54777810 |
atccaatggtctgtacttggcaaattcctttagccagtatccagaatcgttaaggttgctcttaatgttaacgattatacctgtccatggcca-acataa |
54777908 |
T |
|
| Q |
108 |
ttctcaacctgcggtgcaggttggttgacagcttcggccaaagccgggggaggtatttggtctgcttcatttactaggtcagtctccaaatactttgcca |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54777909 |
ttctcaacctgcggtacaggttggttgacagcttcggccaaagccgggggaggtatttggtctgcttcatttactaggtcggtctccaaatactttgcca |
54778008 |
T |
|
| Q |
208 |
gagcgaggtggtttgccttttgtttggcg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
54778009 |
gagcgaggtggtttgccttttgtttggcg |
54778037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 52283994 - 52283766
Alignment:
| Q |
8 |
atccaatggtctgtacttggcaaattcctttagccagtatccagcatcgttaaagttgctcttaatgttaacgattatgcctgtccatggccagacataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| || | ||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
52283994 |
atccaatggtctgtacttggcaaattcctttagccagtatccagaatcattcagtttgctcttaatattaacaattatgcctgtccatggccagacatag |
52283895 |
T |
|
| Q |
108 |
ttctcaacctgcggtgcaggttggttgacagcttcggccaaagccgggggaggtatttggtctgcttcatttactaggtcagtctccaaatactttgcca |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
52283894 |
ttctcaacctgtggtgcaggttggttgacagcttcggtcaaaggcgggggaggtatttggtctgcttcatttgctaggtcagtctccaaaaactttgcca |
52283795 |
T |
|
| Q |
208 |
gagcgaggtggtttgccttttgtttggcg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52283794 |
gagcgaggtggtttgccttttgtttggcg |
52283766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 146 - 229
Target Start/End: Complemental strand, 799132 - 799049
Alignment:
| Q |
146 |
caaagccgggggaggtatttggtctgcttcatttactaggtcagtctccaaatactttgccagagcgaggtggtttgccttttg |
229 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| ||| ||||||| |||| ||||||||||||| ||||||||||| ||||| |
|
|
| T |
799132 |
caaagccgggcgaggtacttggtctgcttcatttgctaagtcagtcctcaaaaactttgccagagccaggtggtttgctttttg |
799049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University