View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4995_high_11 (Length: 280)
Name: NF4995_high_11
Description: NF4995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4995_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 271
Target Start/End: Complemental strand, 3324301 - 3324046
Alignment:
| Q |
17 |
aataaagaacagcagaatctaaataataatggatatttggtttttatattggatttaacccatccttacaaaaccggtgtttttaggtgccgggggacac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324301 |
aataaagaacagcagaatctaaataataatggatattaggtttttatattggatttaacccatccttacaaaaccggtgtttttaggtgccgggggacac |
3324202 |
T |
 |
| Q |
117 |
tgtttataaactctaatcaggacttatctttattctatgagggattta-gattttcccaataatggagttatggaaatctctatgaatcaattcccaagt |
215 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| |||||||| | |||||||||||||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
3324201 |
cgtttctaaactctaatcaggacttgtctttattctatgtgggatttaggtttttcccaataatggagttatgaaaatctctatgaatgaattccaaagt |
3324102 |
T |
 |
| Q |
216 |
ttagcttgggaacaacaactagaagaaatgtagctgcagggctttcagagaataat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| | |||||| |
|
|
| T |
3324101 |
ttagcttgggaacaacaactagaagaaatgaagctgcagggctttcataaaataat |
3324046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 48 - 92
Target Start/End: Complemental strand, 24231902 - 24231858
Alignment:
| Q |
48 |
gatatttggtttttatattggatttaacccatccttacaaaaccg |
92 |
Q |
| |
|
|||||| || ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
24231902 |
gatattaggattttagattggatctaacccatccttacaaaaccg |
24231858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University