View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4995_low_12 (Length: 259)
Name: NF4995_low_12
Description: NF4995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4995_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 49302964 - 49303190
Alignment:
| Q |
18 |
tgtctcaggttagtgttggtacatttcaaaatgtttaccccgtttgacctgccttcattctctgtcaacttattttacggatttgcatatatgaaaatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49302964 |
tgtctcaggttagtgttggtacatttcaaaatgtttaccccgtttgacctgccttcattctctgtcaacttattttacggatttgcatatatgaaaatca |
49303063 |
T |
 |
| Q |
118 |
aaagatatattacaaagaaatgaaaaatatcgtcacattaccccgttgagaaatcttaaataatcatgttttttaatgataaatgttaatatgcctattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49303064 |
aaagatatattacaaagaaatgaaaaatatcgtcacattaccccgttgagaaatcttaaataatcatgttttttaatgataaatgttaatatgcctattg |
49303163 |
T |
 |
| Q |
218 |
ttattttagtattttcacccagcacat |
244 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
49303164 |
ttattttagtattttcacccaccacat |
49303190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University