View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4995_low_14 (Length: 246)
Name: NF4995_low_14
Description: NF4995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4995_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 240
Target Start/End: Complemental strand, 38438990 - 38438756
Alignment:
| Q |
5 |
aaggaacatcttcatatttttcccagataaacattgctccaaacgttttagtcacccttattggcttataaacaaaacaaagagttgaatatttgcttaa |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |||||||| | || |
|
|
| T |
38438990 |
aaggatcatcttcatatttttcccagataaacattgctccaaacgttttagtcacccttactggcttataaacaaaacaaagggttcaatatttgataaa |
38438891 |
T |
|
| Q |
105 |
aaaccacaggcataatatattgaaaaacatcaaggattgctcctgtttcacatcaaattgattgacaaaaaatggttgcttttgagacttgatacggtgg |
204 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38438890 |
aaatcacaggcataatatatt-aaaaacatcaaggattgctcctgtttcacatcaaattgattgacaaaaaatggttgcttttgagacttgatacggtgg |
38438792 |
T |
|
| Q |
205 |
tcgatgcaatgggtggtggatggacttgtatctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
38438791 |
tcgatgcaatgggtggtggatggacttgtatctgtg |
38438756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 174 - 236
Target Start/End: Original strand, 15666859 - 15666921
Alignment:
| Q |
174 |
aaatggttgcttttgagacttgatacggtggtcgatgcaatgggtggtggatggacttgtatc |
236 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
15666859 |
aaatggctgctttttagacttgatgttgtggttgatgcagtgggtggtggatggacttgtatc |
15666921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University