View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4995_low_15 (Length: 243)
Name: NF4995_low_15
Description: NF4995
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4995_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 1897341 - 1897495
Alignment:
| Q |
1 |
cactctagttcacaaatgagtcatattgtttgcttgccttcggataaaagttatagtaaagtttggaaaagaacgaataacagttttaaaaccacataaa |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1897341 |
cactctagttcacaaatgagttatattgtttgcttgccttcggataaaagttatagtaaagtttggaaaacaacgaataacagttttaaaaccacataaa |
1897440 |
T |
|
| Q |
101 |
atagcatcaaactctaacttaagac-aggatacccactatgtcatccaacaacta |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1897441 |
atagcatcaaactctaacttaagactaggatacccactatgtcatccaacaacta |
1897495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 191 - 224
Target Start/End: Original strand, 1897496 - 1897529
Alignment:
| Q |
191 |
ccaaattcataagcaagagaagagcttgcattaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1897496 |
ccaaattcataagcaagagaagagcttgcattaa |
1897529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University