View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4996-Insertion-4 (Length: 418)
Name: NF4996-Insertion-4
Description: NF4996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4996-Insertion-4 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 8 - 418
Target Start/End: Complemental strand, 42666232 - 42665811
Alignment:
| Q |
8 |
gctcttggggtgccaagatggtgttcagtgtttgagattatggctttgttgatgnnnnnnnnnnnn-catgtttaggagcatctcagcaaggatcaaatg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42666232 |
gctcttggggtgccaagatggtgttcagtgtttgagattatggctttgttgatgttttttctctcttcatgtttaggagcatctcagcaaggatcaaatg |
42666133 |
T |
|
| Q |
107 |
gaaatgtttgtgatgataatttgaggcatttgatagaagtttttggtgtaatgaatgttctttgattgtgactcaaactacctagttccaagctg----c |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42666132 |
gaaatgtttgtgatgataatttgaggcatttgatagaagtttttggtgtaatgtatgttctttgattgtgactcaaactacctagttccaagctgtgcgc |
42666033 |
T |
|
| Q |
203 |
atggatacttgatggctcacaccaccacccaagagtatcaacgtacgggtattgggtgagatatgaacactgctatataaagtctatttagtgcatatct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42666032 |
atggatacttgatggctcacaccaccacccaagagtatcaacgtacgggtattgggtgagatatgaacactgctatataaagtctatttattgcatatct |
42665933 |
T |
|
| Q |
303 |
cttatgttttccgcaatgatttttattatgtttgtgtatgtgttatggactttatatgcaatg------gtatgagctaacatggtgtaattnnnnnnnn |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42665932 |
cttatgttttccgcaatgatttttattatgtttgtgtatgtgttatggactttatatgcaatggtattggtatgagctaacatggtgtaattaaaaaaaa |
42665833 |
T |
|
| Q |
397 |
tctcgactatgaactacatcca |
418 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
42665832 |
tctcgactatgaactacatcca |
42665811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University