View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4997_low_3 (Length: 414)
Name: NF4997_low_3
Description: NF4997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4997_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-122; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-122
Query Start/End: Original strand, 83 - 305
Target Start/End: Original strand, 36524234 - 36524456
Alignment:
| Q |
83 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524234 |
ttcgcgaggtgaaaatgagcatagtgcaagagcttgaatttgagaagaagataaggaggcaaactgagagactgaacatgaagatttccaaagaaatgga |
36524333 |
T |
|
| Q |
183 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaagggctaaagagattttggagcaagtttgtgatgaattagccaaaggc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36524334 |
gaacataaaagattcctattcaaaactctctaaggaacacgaaatggagaaaagggctaaagagattttggagcaagtttgtgatgaattagccaaaggc |
36524433 |
T |
|
| Q |
283 |
gttggagaagatagagcacaagt |
305 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36524434 |
gttggagaagatagagcacaagt |
36524456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 39
Target Start/End: Original strand, 36524160 - 36524190
Alignment:
| Q |
9 |
gaacaatatcgagtatctcatgaagcatttt |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36524160 |
gaacaatatcgagtatctcatgaagcatttt |
36524190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 365 - 398
Target Start/End: Original strand, 36524516 - 36524549
Alignment:
| Q |
365 |
tgcttcagttagctgacattttgcgcgaagaacg |
398 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
36524516 |
tgcttcagttagccgacattttgcgcgaagaacg |
36524549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University