View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4997_low_4 (Length: 350)
Name: NF4997_low_4
Description: NF4997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4997_low_4 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 307
Target Start/End: Complemental strand, 38659061 - 38658771
Alignment:
| Q |
18 |
attccaacacccctctttcgttttttgtgagactcattatcataggattaataagttgttataaattacacgattcatcctgtattagaattttcttnnn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
38659061 |
attccaacacccctctttcgttttttgtgagactcattgtcataggattaataagttgttataaaatacacgattcatcctatattagaattttcttaaa |
38658962 |
T |
 |
| Q |
118 |
nnnnnn-tcttatattaggaatatttatataacgattgcattgtaaatggttccacttaatattctttttctacggttgtaattattgctttttaaaagg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38658961 |
aaaaaaatcttatattaggaatatttatataacgattgcattgtaaatggttccacttaatattctttttctacggttgtaattattgctttttaaaagg |
38658862 |
T |
 |
| Q |
217 |
ttcatatattaatcataatcctcaatttagatttggtaatgttattaaatatgcaaatatatgtttttggtgtcctatattttggacatta |
307 |
Q |
| |
|
|| ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38658861 |
ttgatatattaatcttaatcctcaatttagattttgtaatgttattaaatatgcaaatatatgtttatggtgtcctatattttggacatta |
38658771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 184
Target Start/End: Complemental strand, 17707 - 17647
Alignment:
| Q |
124 |
tcttatattaggaatatttatataacgattgcattgtaaatggttccacttaatattcttt |
184 |
Q |
| |
|
|||||| |||||| ||||||||||| ||||||||| ||||| |||| |||| |||||||| |
|
|
| T |
17707 |
tcttatcttaggattatttatataaggattgcatttcaaatgattcctcttagtattcttt |
17647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University