View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4997_low_7 (Length: 201)

Name: NF4997_low_7
Description: NF4997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4997_low_7
NF4997_low_7
[»] chr4 (1 HSPs)
chr4 (17-121)||(18827398-18827503)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 18827398 - 18827503
Alignment:
17 cacagaacttatgtaccatagaacatgctatt-gaaaaaagcttttaatcttccatcattgtggcagattataactattggtataatgactattgaatgt 115  Q
    |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18827398 cacagaacttatgtaccatagaacatgctatttgaaaaaggcttttaatcttccatcattgtggcagattataactattggtataatgactattgaatgt 18827497  T
116 tgtaac 121  Q
    ||||||    
18827498 tgtaac 18827503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University