View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4997_low_7 (Length: 201)
Name: NF4997_low_7
Description: NF4997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4997_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 17 - 121
Target Start/End: Original strand, 18827398 - 18827503
Alignment:
| Q |
17 |
cacagaacttatgtaccatagaacatgctatt-gaaaaaagcttttaatcttccatcattgtggcagattataactattggtataatgactattgaatgt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18827398 |
cacagaacttatgtaccatagaacatgctatttgaaaaaggcttttaatcttccatcattgtggcagattataactattggtataatgactattgaatgt |
18827497 |
T |
 |
| Q |
116 |
tgtaac |
121 |
Q |
| |
|
|||||| |
|
|
| T |
18827498 |
tgtaac |
18827503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University