View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4998_high_4 (Length: 277)
Name: NF4998_high_4
Description: NF4998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4998_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 44772084 - 44772168
Alignment:
| Q |
1 |
ctcgagttaagggcacccttggctatcttgcaccaaaatatgctagtttaggcaaagtaaacgagagttgtgatttctacagttt |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||| |||| || |||||||||||| |||||||||| |
|
|
| T |
44772084 |
ctcgagttaagggcacccttggctatcttgcaccagaatatgctatgttaggtaaagctaatgagagttgtgatgtctacagttt |
44772168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University