View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4998_high_7 (Length: 239)
Name: NF4998_high_7
Description: NF4998
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4998_high_7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 40952783 - 40953008
Alignment:
| Q |
18 |
taggttaggaaagaagcatatactagcaatcactaattaagctcttgatgtcccaattatatagatacacgactttaggagatt----aatgataaggga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40952783 |
taggttaggaaagaagcatatactagcaatcactaattaagctcttgatgtcccaattatatagatacacgactttaggagattaatgaatgataaggga |
40952882 |
T |
|
| Q |
114 |
ataaattcatgaaacatgtgaataacagcgcacaaggatgggaacccaaaccnnnnnnnnnacaatgatttagattcttataccactttttctcttgcca |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40952883 |
ataaattcatgaaccatgtgaataacagcgcacaaggatgggaacccaaacctttttttttacaatgatttagattcttataccactttttctcttgcca |
40952982 |
T |
|
| Q |
214 |
tttctagctagaataaccaacttttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40952983 |
tttctagctagaataaccaacttttt |
40953008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University