View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4999-Insertion-4 (Length: 202)
Name: NF4999-Insertion-4
Description: NF4999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4999-Insertion-4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 197
Target Start/End: Complemental strand, 49996988 - 49996799
Alignment:
| Q |
8 |
caaagcacattggtgatcccagcagagttgagactaaagatactcccaagaataaaaagtttggcacaaagagggcaggtcagtgttcaaactgtaatag |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49996988 |
caaagcacattggtgatcccaacagagttgagactaaagatactcccaagaataaaaagtttggcacaaagagggcaggtcagtgttaaaactgtaatag |
49996889 |
T |
 |
| Q |
108 |
cacaaaatacaaggttaaaccatgtcaaatgcatgctggtgtaaatgataagagtatggatgatgatcagtcatctcatccggagccttc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
49996888 |
cacaaaatacaaggttaaaccatgtcaaatgcatgctggtgtaaatgataagagtatgaatgatgatcagtcatcttgtccggagccttc |
49996799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University