View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4999_high_7 (Length: 311)
Name: NF4999_high_7
Description: NF4999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4999_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 17 - 303
Target Start/End: Original strand, 52289182 - 52289468
Alignment:
| Q |
17 |
agtaaatgcacacactgaataaaactgacttgagaaatgtcccgacaaataatggtgggaggagtggacttaggccggattgcctgcaaagctcgagact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52289182 |
agtaaatgcacacactgaataaaactgacttgagaaatgtcccgacaaataatggtgggaggagtggacttaggccggaatgcctgcaaagctcgagact |
52289281 |
T |
 |
| Q |
117 |
ttggtttatcatcattttttaacaaattcctaccaactttggtttttatctcttctcttcnnnnnnncaaagcaaagcaacaaggtcctatctattcctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52289282 |
ttggtttatcatcattttttaacaaattcctaccaactttggtttttatctcttctcttctttttttcaaagcaaagcaacaaggtcctatctattcctt |
52289381 |
T |
 |
| Q |
217 |
ctttttctcccaatatctattgtttgtttaagatgcgttagctaacattcatgaacaatgcttagtgctttctcgttcattcatctc |
303 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
52289382 |
ctttttctcccaatatgtattgtttgtttaagatgcgttagctaacattcatgaacaatgcttagtgctttctggttcattcttctc |
52289468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University