View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4999_high_9 (Length: 239)
Name: NF4999_high_9
Description: NF4999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4999_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 55070155 - 55070375
Alignment:
| Q |
1 |
ttattttaagtatttagggttagttttgagtttttgtttggataaagataaggcctgaaagagtttataaagactatcaatctttacgccggttttttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
55070155 |
ttattttaagtatttagggttagttttgagtttttgtttggataaagataaggcctgaaagagtttataaagactatcaatctttacgccggttttgtaa |
55070254 |
T |
 |
| Q |
101 |
ggatgtgttagacccaatatccaccaaactcaatagtgttgggcgtgggagagtgtactcttagaaatcgtagttggacatatggccgatggatcttgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55070255 |
ggatgtgttagacccaatatccaccaaactcaatagtgttgggcgtgggaaagtgtactcttagaaatcgtagttggacatatggccgatggatcttgag |
55070354 |
T |
 |
| Q |
201 |
gaggctctgatactatcttac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
55070355 |
gaggctctgatactatcttac |
55070375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 189 - 220
Target Start/End: Complemental strand, 5594138 - 5594107
Alignment:
| Q |
189 |
atggatcttgaagaggctctgatactatctta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5594138 |
atggatcttgaagaggctctgatactatctta |
5594107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 186 - 220
Target Start/End: Original strand, 18333668 - 18333702
Alignment:
| Q |
186 |
ccgatggatcttgaagaggctctgatactatctta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |
|
|
| T |
18333668 |
ccgatggatcttgaagaggctctgataccatctta |
18333702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University