View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5000_low_12 (Length: 242)
Name: NF5000_low_12
Description: NF5000
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5000_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 31746453 - 31746677
Alignment:
| Q |
1 |
taatttatggttgagtctaacacaacccgcaaaactgacttataagatgagaattgacctcattcataaaatcatgttcattcaatctattatccaatgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31746453 |
taatttatggttgagtctaacacaacccgcaaaattgacttgtaagatgataattgaccccattcataaaatcacgttcattcaatctattatccaatgc |
31746552 |
T |
|
| Q |
101 |
gagactctttaacacaccacaaatattatttggtttgatgcatgatattaatgatggatggaaaataacggaaacatgataattgtgactcaatagatct |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31746553 |
gagact-tttaacacaccacaaatattatttggtttgatgcatgatattaa-ggtggatggaaaataacggaaacatgataattgtgactcaatagatct |
31746650 |
T |
|
| Q |
201 |
tgaaggagactctgatagcactttatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31746651 |
tgaaggagactctgatagcactttatt |
31746677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University