View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5001_high_3 (Length: 298)
Name: NF5001_high_3
Description: NF5001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5001_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 9 - 280
Target Start/End: Complemental strand, 3425336 - 3425065
Alignment:
| Q |
9 |
gcaatagcagacatcaaatcacaacggtaccgggatagcaccagcgccgcaatggcgctgctttttaaccactaatataggccgctagtgatgatactct |
108 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425336 |
gcaatagcagatatcaaatcacaacggtaccgggatagcaccagcgccgcaatggcgctgctttttaaccactaatataggccgctagtgatgatactct |
3425237 |
T |
 |
| Q |
109 |
caatggcgcttttcgggcctatggtgcggaagtggagggcagcgccgccaaactacaccgctatagcgtgctattgacaacatagctgaaataaaaattc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3425236 |
caatggcgcttttcgggcctatggtgcggaagtggagggcagcgctgccaaactacaccgctatagcgtgctattggcaacatagctgaaataaaaattc |
3425137 |
T |
 |
| Q |
209 |
ctgaaattttcaaattgattgcggattaaacaatccctttggctcttaaacgttgtggtgttgcgacaatag |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3425136 |
ctgaaattttcaaattgattgcggattaaacaatccctttggctcttaaacgttgtggtgttgcgacaatag |
3425065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 195
Target Start/End: Original strand, 9832953 - 9832993
Alignment:
| Q |
155 |
gccaaactacaccgctatagcgtgctattgacaacatagct |
195 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9832953 |
gccacactacaccgctatagtgtgctattgacaacatagct |
9832993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University