View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5001_high_6 (Length: 228)
Name: NF5001_high_6
Description: NF5001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5001_high_6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 37655624 - 37655414
Alignment:
| Q |
18 |
ctatcacgcttcaagagtttattgagctaagcacaacaagctatgaatctgaagaggaaatagaaaacctaaagagcacgttttctgtgtatgacattga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37655624 |
ctatcacgcttcaagagtttattgagctaagcacaacaagctatgaatctgaagaggaaatagaaaacctaaagagcacgttttctgtgtatgacattga |
37655525 |
T |
|
| Q |
118 |
tggcgatggtttcatcacagcgaaggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaattattggtcgcgtt |
217 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37655524 |
tggcgatggtttcatcacggcgaaggagcttaacacgcttatgagaagcattggtcaagagtgttccttggatgaatgtgaaagaattattggtcgcgtt |
37655425 |
T |
|
| Q |
218 |
gatagtgatgg |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
37655424 |
gatagtgatgg |
37655414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University