View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5001_low_4 (Length: 338)

Name: NF5001_low_4
Description: NF5001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5001_low_4
NF5001_low_4
[»] chr8 (2 HSPs)
chr8 (33-113)||(44227348-44227429)
chr8 (20-107)||(44231634-44231722)
[»] chr6 (1 HSPs)
chr6 (47-107)||(31368397-31368457)


Alignment Details
Target: chr8 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 33 - 113
Target Start/End: Original strand, 44227348 - 44227429
Alignment:
Q  33 tgcaattagctataaatagctttgtaatcagttgagcacttaagcaaaatcatttca-tttttcagtttcataatatggtat 113  Q
    |||||||||||||| ||||||||||||| | |||| | |||||  |||||||||||| ||||||||||||||||||||||||    
T  44227348 tgcaattagctatatatagctttgtaattacttgaactcttaaagaaaatcatttcattttttcagtttcataatatggtat 44227429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 20 - 107
Target Start/End: Original strand, 44231634 - 44231722
Alignment:
Q  20 gttatggtacacatgcaattagctataaatagctttgtaatcagttgagcacttaagcaaaatcatttca-tttttcagtttcataata 107  Q
    |||||||||  | |||||| ||||||| ||||||||||||| | |||| | |||||| |||||||||||| ||||||||||||||||||    
T  44231634 gttatggtattcttgcaatgagctatatatagctttgtaattacttgaactcttaaggaaaatcatttcattttttcagtttcataata 44231722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 47 - 107
Target Start/End: Original strand, 31368397 - 31368457
Alignment:
Q  47 aatagctttgtaatcagttgagcacttaagcaaaatcatttcatttttcagtttcataata 107  Q
    |||||||||||||| | |||| | |||||| ||||||||||||||||||||||||||||||    
T  31368397 aatagctttgtaattacttgaactcttaaggaaaatcatttcatttttcagtttcataata 31368457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University