View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5001_low_8 (Length: 240)
Name: NF5001_low_8
Description: NF5001
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5001_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 51812089 - 51812311
Alignment:
| Q |
1 |
tatatttgttgatttaactttcttttaggagtatttttgaaaatccagacgtgtctattctttataaattgctttgatcatcttcgcacttgttggagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
51812089 |
tatatttgttgatttaactttcttttaggagtatttttgaaaatccagacatgtctattctttataaattgctttgatcatctttgcacttgttggagac |
51812188 |
T |
|
| Q |
101 |
ccataatttcttttgaagctgctattattttttcacgtagaagnnnnnnntagttatatttatgctcgtgtcaaataaacaacgtatatcaaccttttaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51812189 |
ccataatttcttttgaagctgctattattttttcacgtagaagaaaaaaatagttatatttatgctcgtgtcaaataaacaacgtatatcaaccttttaa |
51812288 |
T |
|
| Q |
201 |
aaagattatgctctatcaatatt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51812289 |
aaagattatgctctatcaatatt |
51812311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University