View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5002_low_2 (Length: 278)
Name: NF5002_low_2
Description: NF5002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5002_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 20 - 267
Target Start/End: Complemental strand, 41737291 - 41737044
Alignment:
| Q |
20 |
cttctacctataaatgatatgtaaggctttgtttttggcacaaacactctttctctgcacaaattgtacaaaaagcaatggttataaagaaagaaagnnn |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41737291 |
cttctacctataaatgatatgtaaggctttgtttttggcacaaacactctttctctgcacaaattgtacataaagcaatggttataaagaaagaaagaaa |
41737192 |
T |
 |
| Q |
120 |
nnnngaacaaatcacgtttctacctccatagcaccgacaattttcatcaaatgtatgtctagtgtcggtgtccgacacatacaatcgttaattcattttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41737191 |
aaatgaacaaatcacgtttctacctccatagcaccgacaattttcatcaaatgtatgtctagtgtcggtgtccgacacatacaatcgttaattcattttc |
41737092 |
T |
 |
| Q |
220 |
tcaaattacgagaggtgtcaacgtgtcagtgtcgtgtctggtgtctgt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41737091 |
tcaaattacgagaggtgtcaacgtgtcagtgtcgtgtctggtgtctgt |
41737044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 268
Target Start/End: Original strand, 42720925 - 42720979
Alignment:
| Q |
214 |
attttctcaaattacgagaggtgtcaacgtgtcagtgtcgtgtctggtgtctgtg |
268 |
Q |
| |
|
||||| |||||||| || |||||||||||||||||||| |||||| |||||||| |
|
|
| T |
42720925 |
attttttcaaattattagcggtgtcaacgtgtcagtgtcatgtctgatgtctgtg |
42720979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 258
Target Start/End: Complemental strand, 11815854 - 11815809
Alignment:
| Q |
213 |
cattttctcaaattacgagaggtgtcaacgtgtcagtgtcgtgtct |
258 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11815854 |
cattttctcaaattattattggtgtcaacgtgtcagtgtcgtgtct |
11815809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 211 - 264
Target Start/End: Complemental strand, 43328494 - 43328441
Alignment:
| Q |
211 |
ttcattttctcaaattacgagaggtgtcaacgtgtcagtgtcgtgtctggtgtc |
264 |
Q |
| |
|
||||||||||||||||| | | |||||||||||||||||| |||||| ||||| |
|
|
| T |
43328494 |
ttcattttctcaaattattataagtgtcaacgtgtcagtgttgtgtctagtgtc |
43328441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 262
Target Start/End: Complemental strand, 15544717 - 15544669
Alignment:
| Q |
214 |
attttctcaaattacgagaggtgtcaacgtgtcagtgtcgtgtctggtg |
262 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
15544717 |
attttatcaaattattagcggtgtcaacgtgtcagtgtcgtgtcaggtg |
15544669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University