View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5002_low_5 (Length: 241)

Name: NF5002_low_5
Description: NF5002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5002_low_5
NF5002_low_5
[»] chr7 (2 HSPs)
chr7 (20-92)||(7774082-7774154)
chr7 (195-241)||(7773933-7773979)


Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 7774154 - 7774082
Alignment:
20 tagggttcgttccatctttctcccattttcttcctctcaggtttgttcttcaaatccatcgattaaatccctt 92  Q
    |||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||||||||||||    
7774154 tagggttcgttccatctttctctcattttcttcctttcaggttcgttcttcaaatccatcgattaaatccctt 7774082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 7773979 - 7773933
Alignment:
195 taactgattaaattctgttttaattattatagatgcattaacaacat 241  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||    
7773979 taactgattaaattctgttttgattattatagatgcattaacaacat 7773933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University