View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5002_low_5 (Length: 241)
Name: NF5002_low_5
Description: NF5002
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5002_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 20 - 92
Target Start/End: Complemental strand, 7774154 - 7774082
Alignment:
| Q |
20 |
tagggttcgttccatctttctcccattttcttcctctcaggtttgttcttcaaatccatcgattaaatccctt |
92 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7774154 |
tagggttcgttccatctttctctcattttcttcctttcaggttcgttcttcaaatccatcgattaaatccctt |
7774082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 195 - 241
Target Start/End: Complemental strand, 7773979 - 7773933
Alignment:
| Q |
195 |
taactgattaaattctgttttaattattatagatgcattaacaacat |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7773979 |
taactgattaaattctgttttgattattatagatgcattaacaacat |
7773933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University