View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5003_high_1 (Length: 334)
Name: NF5003_high_1
Description: NF5003
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5003_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 1537492 - 1537798
Alignment:
| Q |
19 |
gagttgagaagcaagatcgaattgatgaactttggagacaatatcgatgaggagattgtaggattgaagagagagaggtgggtttgggagagatttggag |
118 |
Q |
| |
|
|||||| ||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537492 |
gagttgcgaagcgaggtcgaattgatgaactttggagacaatatcaatgaggagattgtaggattgaagagagagaggtgggtttgggagagatttggag |
1537591 |
T |
 |
| Q |
119 |
aaattgtgaagggaaagagcgattttggagtggtgtttgaggagagttagggtttgggttaagagaattggggttagggttatgccattgagttgaaggg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537592 |
aaattgtgaagggaaagagcgattttggagtggtgtttgaggagagttagggtttgggttaagagaattggggttagggttatgccattgagttgaaggg |
1537691 |
T |
 |
| Q |
219 |
aagattctgtgaagtggtaagggttgtggtgtgttaggagtattttggagattaattcggcgtcgttttgggtttgtgaagagattgaagagaagaagcg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1537692 |
aagattctgtgaagtggtaagggttgtggtgtgttaggagtattttggagattaattcggcgtcgttttgggtttgtgaagagattgaagagaagaagcg |
1537791 |
T |
 |
| Q |
319 |
tgtgatg |
325 |
Q |
| |
|
||||||| |
|
|
| T |
1537792 |
tgtgatg |
1537798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University