View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5004-Insertion-5 (Length: 302)
Name: NF5004-Insertion-5
Description: NF5004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5004-Insertion-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 4785750 - 4785696
Alignment:
| Q |
151 |
tctgaagatgcaaacatatccctcaatcattattgaaaatagctggattcatcat |
205 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4785750 |
tctgaaaatgcaaacatatccctcaatcattattgaaaatagctggattcatcat |
4785696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University