View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5004-Insertion-9 (Length: 158)
Name: NF5004-Insertion-9
Description: NF5004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5004-Insertion-9 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 5893501 - 5893652
Alignment:
| Q |
8 |
ggttagtcacttatcattactctttaatccttttaaataatcaannnnnnnattaaagttaaaaaa-tgaggtggatattcaataataattaagcattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
5893501 |
ggttagtcacttatcattactctttagtccttttaaataatcaatttttttattaaagttaaaaaaatgatgtggatattcaataataattaagcattat |
5893600 |
T |
 |
| Q |
107 |
catataattacttagaatgtttcctgtttgttttgcagtccttgatatttgc |
158 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
5893601 |
catataattacatagaatgtttcttgtttgttttgcagtcattgatatttgc |
5893652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University