View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5004_high_3 (Length: 229)
Name: NF5004_high_3
Description: NF5004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5004_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 224
Target Start/End: Complemental strand, 48484893 - 48484678
Alignment:
| Q |
9 |
attaattttgcttgcagagtttggtgcaagtgtagcacgtgtgggtcaaaaaagcaggcattggcagaatgggaacggcatacaggttgtacggccaaaa |
108 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48484893 |
attaatttttcttgcagagttttgtgcaagtgtatcacgtgtgggtcaaaaaagcaggcattggcagaatgggaacggcatacaggttgtacagccaaaa |
48484794 |
T |
|
| Q |
109 |
aatggaaacatagtgtgaaagtagaaggcacaatgcaaccactaataaaatgggtatgtgtcatatcttgctagattaatatgtgacaaatctttcttat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48484793 |
aatggaaacatagtgtgaaagtagaaggcacaatgcaaccactaataaaatgggtatgtgtcatatcttgctagattaatatgtgacaaatctttcttat |
48484694 |
T |
|
| Q |
209 |
tattctcactttaagt |
224 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
48484693 |
tattctcacttgaagt |
48484678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University