View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5004_low_2 (Length: 382)
Name: NF5004_low_2
Description: NF5004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5004_low_2 |
 |  |
|
| [»] scaffold0669 (1 HSPs) |
 |  |  |
|
| [»] scaffold0260 (1 HSPs) |
 |  |  |
|
| [»] scaffold0214 (1 HSPs) |
 |  |  |
|
| [»] scaffold0573 (1 HSPs) |
 |  |  |
|
| [»] scaffold1414 (1 HSPs) |
 |  |  |
|
| [»] scaffold1371 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 33908959 - 33908631
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908959 |
cactacaagaataatgaccctttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
33908860 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgcttgtcagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33908859 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgtgggaatctgtgcttgtcagca |
33908760 |
T |
 |
| Q |
236 |
aaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
335 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33908759 |
aaaaccgacggaaaaagccagggaacagcccctcggtttgcgaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
33908660 |
T |
 |
| Q |
336 |
gagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
33908659 |
gagcgctgccggcctgccaggggcggaac |
33908631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 36 - 181
Target Start/End: Complemental strand, 18554461 - 18554316
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
18554461 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaaaa |
18554362 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
18554361 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
18554316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 23702320 - 23702465
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
23702320 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaaa |
23702419 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
23702420 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
23702465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 23720776 - 23720921
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
23720776 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaaa |
23720875 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
23720876 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
23720921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 23739232 - 23739377
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
23739232 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaaccgctggcaaaaa |
23739331 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
23739332 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
23739377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 35 - 119
Target Start/End: Original strand, 6305833 - 6305917
Alignment:
| Q |
35 |
gcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaagga |
119 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||| ||||||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
6305833 |
gcactacaagaaatatgacattttgccagggattttgacaggggtttggtacccctggcaaatttgtcagggaaaatgccaagga |
6305917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 65 - 124
Target Start/End: Original strand, 46830165 - 46830224
Alignment:
| Q |
65 |
gattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46830165 |
gattttgacaggggtaagaaacccctggcaaatttgccagggaaaataccaaggataacc |
46830224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 60 - 111
Target Start/End: Original strand, 20850234 - 20850285
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaat |
111 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20850234 |
ccagggattttggcaggggtttgaaacccctggcaaatttgccaaggaaaat |
20850285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 34 - 364
Target Start/End: Original strand, 35593209 - 35593539
Alignment:
| Q |
34 |
agcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcaca |
133 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35593209 |
agcactacaagaataatgaccctttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcaca |
35593308 |
T |
 |
| Q |
134 |
aaagacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgcttgtcag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
35593309 |
aaagacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgtgggaatctgtgcttatcag |
35593408 |
T |
 |
| Q |
234 |
caaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaag |
333 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35593409 |
caaaaaccgacggaaaaagccagggaacagcccctcggtttgcgaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaag |
35593508 |
T |
 |
| Q |
334 |
ctgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |
|
|
| T |
35593509 |
ctgagcgctgccggcctgccaggggcggaac |
35593539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 4969119 - 4968791
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4969119 |
cactacaagaataatgaccctttgccagagattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
4969020 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgcttgtcagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
4969019 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgtgggtatctgtgcttgtcagca |
4968920 |
T |
 |
| Q |
236 |
aaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
335 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4968919 |
aaaaccgacggaaaaagccagggaacagcccctcggtttgcgaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
4968820 |
T |
 |
| Q |
336 |
gagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
4968819 |
gagcgctgccggcctgccaggggcggaac |
4968791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 35 - 360
Target Start/End: Complemental strand, 37393340 - 37393015
Alignment:
| Q |
35 |
gcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaa |
134 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37393340 |
gcactacaagaataatgaccttttgccaaggattttgacaagggtttgatacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaa |
37393241 |
T |
 |
| Q |
135 |
aagacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||| | ||| | ||||||||| ||||| ||||||||||| ||||||||| |||| |||||| |
|
|
| T |
37393240 |
aagacagggatttgcccctcgctttttgtc-aaaatccctggctttattttaggcgccagattgaattttgaaaatctaagggaatctctgctatgtcag |
37393142 |
T |
 |
| Q |
234 |
caaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaag |
333 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| ||||||| ||||||| || | |||| ||| ||||||||||||||||||||| |
|
|
| T |
37393141 |
agaaaaccgacagaaaaagccagggaactgcccctcggtttccgaaattcaaaggattccctgctttgttccagttgacttgacaagggcctgccaaaag |
37393042 |
T |
 |
| Q |
334 |
ctgagcgttgccggcctgccaggggcg |
360 |
Q |
| |
|
||| ||| || ||||||||||||||| |
|
|
| T |
37393041 |
ctgtccgtcgcaggcctgccaggggcg |
37393015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 36 - 360
Target Start/End: Complemental strand, 11882285 - 11881961
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
11882285 |
cactacaagaataatgaccttttgccagggattttgacaagggtttgatacccctggcaaatttgtcagggaaaataccaaggaaaactggtggcacaaa |
11882186 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagc |
234 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| | ||| | ||||||||||||||| ||||||||||| ||||||||| |||| |||||| |
|
|
| T |
11882185 |
agacagggatttgcccctcgctttttgtc-aaaatccctggctttattttaggcgccagtttgaattttgaaaatctaagggaatctctgctatgtcaga |
11882087 |
T |
 |
| Q |
235 |
aaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||| ||| ||||||| || | |||| |||||||||||||||||||||||||| |
|
|
| T |
11882086 |
gaaaaccgacggaaaaagccagggaactgcccctcggtttccgaaattcaagggattccctgctttgttccagttgagttgacaagggcctgccaaaagc |
11881987 |
T |
 |
| Q |
335 |
tgagcgttgccggcctgccaggggcg |
360 |
Q |
| |
|
|| || || ||||||||||||||| |
|
|
| T |
11881986 |
tgtccgacgcaggcctgccaggggcg |
11881961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 97 - 364
Target Start/End: Original strand, 40654247 - 40654514
Alignment:
| Q |
97 |
tttgccagggaaaataccaaggaaaaccggtggcacaaaagacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| | ||||||||||| |
|
|
| T |
40654247 |
tttgccagggaaaataccaaggaaaaccggtggcacaaaagacagggatttgcccctcgctttttgccaaaa-tccgtcggttttttttaggcgccagtt |
40654345 |
T |
 |
| Q |
197 |
tgaaatttgaaaatctgagggaatctgtgct-tgtcagcaaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccct |
295 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
40654346 |
tgaattttgaaaatctgagggaatctctgctatgtcagctaaaaacgacggaaaaagccagggaactgcccctcggtttgcgaaaatcaaaggattccct |
40654445 |
T |
 |
| Q |
296 |
gcgttttcccagctgagttgacaagggcctgccaaaagctgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||| ||| ||||||| |||||||||| |||| |
|
|
| T |
40654446 |
gcgttttcccagctgacttgacaagggcctgcaaaaagctgtgcgctgccggcatgccaggggcagaac |
40654514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 36 - 162
Target Start/End: Complemental strand, 7094941 - 7094814
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||| |||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
7094941 |
cactacaagaataatgaccttttgccagaaattttgtcaagggtttgaaacccctggcaaatttgccagggaaaatgccaaggacaaccgctggcataaa |
7094842 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttg |
162 |
Q |
| |
|
||||||||| |||||||||||||||||| |
|
|
| T |
7094841 |
agacagggactttgcccctcgctttttg |
7094814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 1696879 - 1696967
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| || ||| ||| ||||||||||||||| || ||| |||||||||| |||| | ||| ||||||| ||||||| |||| |
|
|
| T |
1696879 |
cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacc |
1696967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 124
Target Start/End: Complemental strand, 33058117 - 33058029
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| || ||| ||| ||||||||||||||| || ||| |||||||||| |||| | ||| ||||||| ||||||| |||| |
|
|
| T |
33058117 |
cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacc |
33058029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 11)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 19764491 - 19764163
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19764491 |
cactacaagaataatgaccttttgccagggattttgacaagggtttgaaacccctggcaaatttgacagggaaaataccaaggaaaaccggtggcacaaa |
19764392 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagc |
234 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||| | ||||||||| ||||| ||| ||||||||||||||||| |||| |||||| |
|
|
| T |
19764391 |
agacagggatttgcccctcgctttttg-ccaaaatccctcggttttttttaggcgccagattgaatttttaaaatctgagggaatctctgctatgtcaga |
19764293 |
T |
 |
| Q |
235 |
aaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19764292 |
gaaaaccgacggaaaaagccagggaactgcccctcggtttccgaaaatcaaaggattccctgctttttcccagctgacttgacaagggcctgccaaaagc |
19764193 |
T |
 |
| Q |
335 |
tgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
|| ||||||||||||||||||||||||||| |
|
|
| T |
19764192 |
tgtgcgttgccggcctgccaggggcggaac |
19764163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 7306169 - 7305841
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7306169 |
cactacaagaataatgaccatttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
7306070 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagc |
234 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| ||||| || | ||||||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
7306069 |
agacagggatttgcccctcgctttttg-ccaaaatccgtcggtattttttaggcgccagtttgaattttgaaaatctgagggaatctctgctatgtcaga |
7305971 |
T |
 |
| Q |
235 |
aaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagc |
334 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7305970 |
gaaaaccgatggaaaaagccaaggaactgcccctcggtttgcgaaaatcaaaggattccctgcgttttcccagctgacttgacaagggcctgccaaaagc |
7305871 |
T |
 |
| Q |
335 |
tgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
|| ||| ||||||| ||||||||||||||| |
|
|
| T |
7305870 |
tgtgcgctgccggcatgccaggggcggaac |
7305841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 36 - 162
Target Start/End: Complemental strand, 21781122 - 21780996
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||| |
|
|
| T |
21781122 |
cactacaagaataatgaccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcagaaa |
21781024 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttg |
162 |
Q |
| |
|
||||||||| ||||||||||| |||||| |
|
|
| T |
21781023 |
agacagggactttgcccctcgttttttg |
21780996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 36 - 155
Target Start/End: Complemental strand, 41201912 - 41201793
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||| || || ||||| ||| |
|
|
| T |
41201912 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaattttccagggaaaatgccaaggacaatcgctggcaaaaa |
41201813 |
T |
 |
| Q |
136 |
agacagggatttgcccctcg |
155 |
Q |
| |
|
| || ||| ||||||||||| |
|
|
| T |
41201812 |
acactggggtttgcccctcg |
41201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 36 - 119
Target Start/End: Original strand, 7916208 - 7916291
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaagga |
119 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7916208 |
cactacaagaaatatgacattttaccagggattttgacaggggtttggaacccctggcaaatttgccagggaaaatgccaagga |
7916291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 60 - 162
Target Start/End: Complemental strand, 38705981 - 38705879
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctt |
158 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||||| |||||| ||||||||||| || |
|
|
| T |
38705981 |
ccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaagccagggactttgcccctcgttt |
38705883 |
T |
 |
| Q |
159 |
tttg |
162 |
Q |
| |
|
|||| |
|
|
| T |
38705882 |
tttg |
38705879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 1534009 - 1534097
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| |||| | ||| ||| ||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1534009 |
cactacaagaaaaatgcacatttgccaaggattttgacagggacatgaaacccctggcaaatttgccagggaaaatgccaaggaaaacc |
1534097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 35 - 107
Target Start/End: Complemental strand, 18342080 - 18342009
Alignment:
| Q |
35 |
gcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccaggga |
107 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18342080 |
gcactacaagaataatagccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccaggga |
18342009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 36 - 117
Target Start/End: Original strand, 9670416 - 9670497
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaag |
117 |
Q |
| |
|
||||||||||| |||| || ||| | ||||||||||||| |||| | ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
9670416 |
cactacaagaaaaatgcccatttgctagggattttgacaggggtattttacccctggcaaatttaccagggaaaatgccaag |
9670497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 23769334 - 23769422
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| || ||| ||| ||||||||||||||| || ||| |||||||||| |||| | ||| ||||||| ||||||| |||| |
|
|
| T |
23769334 |
cactacaagaaacattaccttttgccagggattttgacagggttttaaaacccctggtaaatataccacggaaaatgccaaggacaacc |
23769422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 61 - 99
Target Start/End: Original strand, 46419968 - 46420006
Alignment:
| Q |
61 |
cagggattttgacaagggtttgaaacccctggcaaattt |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46419968 |
cagggattttgacaaggccttgaaacccctggcaaattt |
46420006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 37 - 364
Target Start/End: Complemental strand, 16924530 - 16924203
Alignment:
| Q |
37 |
actacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaa |
136 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16924530 |
actacaagaataatgaccttttgctagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaa |
16924431 |
T |
 |
| Q |
137 |
gacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||| |||| | ||||||||| ||||| ||| ||||||||||||||||| |||| ||||| |
|
|
| T |
16924430 |
gacagggatttgcccctcgctttttg-ccaaaatccctcgcttttttttaggcgccagattgaatttttaaaatctgagggaatctctgctatgtcaaag |
16924332 |
T |
 |
| Q |
236 |
aaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16924331 |
aaaaccgacggaaaaagccagggaactgcccctcggtttccgaaaatcaaaggattccctgctttttcccagctgacttgacaagggcctgccaaaagct |
16924232 |
T |
 |
| Q |
336 |
gagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
16924231 |
gtgcgttgccggcctgccaggggcggaac |
16924203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 97 - 364
Target Start/End: Original strand, 32215122 - 32215389
Alignment:
| Q |
97 |
tttgccagggaaaataccaaggaaaaccggtggcacaaaagacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||| ||||||||||||| |
|
|
| T |
32215122 |
tttgccagggaaaataccaaggaaaaccggtggcacaaaagacagggatttgcccctcgctttttgccaaaa-tccgtcggttttattaaggcgccagtt |
32215220 |
T |
 |
| Q |
197 |
tgaaatttgaaaatctgagggaatctgtgct-tgtcagcaaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccct |
295 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
32215221 |
tgaattttgaaaatctgagggaatctctgctatgtcagagaaaaccgacggaaaaagccagggaactgcccctcggtttgcgaaaatcaaaggaacccct |
32215320 |
T |
 |
| Q |
296 |
gcgttttcccagctgagttgacaagggcctgccaaaagctgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32215321 |
gcgttttcccagctgacttgacaagggcctgccaaaagctgagcgctgcgggcctgccaggggcggaac |
32215389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 5322641 - 5322730
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaaggg-tttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| || ||| ||| |||||||||||||| ||| |||||||||||||| |||||| ||||||||||| ||||||| |||| |
|
|
| T |
5322641 |
cactacaagaaacattaccttttgtcagggattttgacagggggtttgaaacccctgggaaatttaccagggaaaatgccaaggataacc |
5322730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 36 - 120
Target Start/End: Original strand, 18912802 - 18912886
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaa |
120 |
Q |
| |
|
||||||||||| |||||| ||| ||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
18912802 |
cactacaagaaaaatgactatttgccagggattttgacagggacaaaaaacctctggcaaatttgccaggaaaaataccaaggaa |
18912886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 61 - 105
Target Start/End: Complemental strand, 34344527 - 34344483
Alignment:
| Q |
61 |
cagggattttgacaagggtttgaaacccctggcaaatttgccagg |
105 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
34344527 |
cagggattttgacaaggccttgaaacccctggcaaatttcccagg |
34344483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 60 - 92
Target Start/End: Original strand, 14649644 - 14649676
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctgg |
92 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
14649644 |
ccagggattttgacaggggtttgaaacccctgg |
14649676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 124
Target Start/End: Complemental strand, 20361081 - 20360993
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
||||||||||| || ||| ||| | ||||||||||||| || |||||||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
20361081 |
cactacaagaaacattaccttttgctagggattttgacagggtcttgaaacccctggcaaatttctcagggactaagccaaggaaaacc |
20360993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 11722729 - 11722401
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11722729 |
cactacaagaataatgaccttttgccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccagtggcacaaa |
11722630 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagc |
234 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||| |||| | ||||||||| ||||| ||| ||||||||||||||||| || |||||| |
|
|
| T |
11722629 |
agacagggatttgcccctcgctttttg-ccaaaatccctcgcttttttttaggcgccagattgaatttttaaaatctgagggaatcttatctatgtcaga |
11722531 |
T |
 |
| Q |
235 |
aaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| ||||||| ||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
11722530 |
gaaaaccgacggaaaaagccagggaactgcccctcgatttccgaaattcaaaggattccctgctttttcccagttgacttgacaagggcctgccaaaagc |
11722431 |
T |
 |
| Q |
335 |
tgagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
|| |||||||| |||||||||||||||||| |
|
|
| T |
11722430 |
tgtgcgttgccagcctgccaggggcggaac |
11722401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 36 - 227
Target Start/End: Complemental strand, 16375999 - 16375808
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
16375999 |
cactgcaagaataatgaccttttgccagggattttgtcaagggtttgaaacccctggcaaatttgccagggaaaatgccaaggacaaccgttggcataaa |
16375900 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct |
227 |
Q |
| |
|
||||||||| ||||||||||| |||||| |||| | | | ||||| | |||||||||||||||| || |||| |||| ||||||| |||| |
|
|
| T |
16375899 |
agacagggactttgcccctcgttttttg-taaaatggcgtggcttttgtttaggcgccagtttgaaaattcaaaagctgaaggaatctctgct |
16375808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 36 - 246
Target Start/End: Original strand, 9763185 - 9763396
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| |||||||||||||||| |||||||||||||| ||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
9763185 |
cactacaagaataatgaccttttgccagggattttgtcaagggtttgaaacccttggcaaatttgccaaggaaaatgccaaggacaaccgctggcataaa |
9763284 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcag |
233 |
Q |
| |
|
|||| |||| ||||||||||| |||||| |||| || | | ||| | | |||||||||||||||| || |||| |||| ||||||| |||| |||||| |
|
|
| T |
9763285 |
agacggggactttgcccctcgttttttg-taaaatgccgtggctttagtttaggcgccagtttgaaaattcaaaagctgaaggaatctctgctgtgtcag |
9763383 |
T |
 |
| Q |
234 |
caaaaaccgacgg |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
9763384 |
agaaaaccgacgg |
9763396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 111
Target Start/End: Complemental strand, 35631506 - 35631424
Alignment:
| Q |
29 |
tatatagcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaat |
111 |
Q |
| |
|
|||||| ||||||||||| || ||| ||| |||| |||||||||| ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
35631506 |
tatataacactacaagaaacattaccatttgccagagattttgacaggggtttgaaacccctggaaaatttaccagggaaaat |
35631424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 44462714 - 44462801
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| |||||||||||| |||||| ||| ||||| | |||||||||||| |
|
|
| T |
44462714 |
cactacaagaataatgcccatttgccagggattttgacaaggacatgaaacccctgggaaattttcca-ggaaattgccaaggaaaacc |
44462801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 36 - 124
Target Start/End: Original strand, 44470245 - 44470332
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||| |||||||||||| |||||| ||| ||||| | |||||||||||| |
|
|
| T |
44470245 |
cactacaagaataatgcccatttgccagggattttgacaaggacatgaaacccctgggaaattttcca-ggaaattgccaaggaaaacc |
44470332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0669 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: scaffold0669
Description:
Target: scaffold0669; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 36 - 364
Target Start/End: Complemental strand, 6908 - 6601
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6908 |
cactacaagaataatgaccctttgccagggattttgacaaggttttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
6809 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgcttgtcagca |
235 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |||||||| |||||||||||||| || |||||||||| ||| |
|
|
| T |
6808 |
agacagggatttgcccctcgctttttg-ccaaaatccgtcggttttattaaggcgccagtttaaattttgaaaatcagag-------------------- |
6730 |
T |
 |
| Q |
236 |
aaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagct |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
6729 |
aaaaccgacggaaaaagccagggaactgcccctcggtttgcgaaaatcaaaggaatccctgggttttccaagctgacttgacaagggcctgccaaaagct |
6630 |
T |
 |
| Q |
336 |
gagcgttgccggcctgccaggggcggaac |
364 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
6629 |
gagcgctgccggcctgccaggggcggaac |
6601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 182; Significance: 3e-98; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 36 - 360
Target Start/End: Complemental strand, 34678745 - 34678421
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678745 |
cactacaagaataatgaccttttgccagggattttgacaagggtttgatacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
34678646 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcagc |
234 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||||| | ||| | ||||||||||||||| ||||||||||| |||||||| |||| |||||| |
|
|
| T |
34678645 |
agacagggatttgccccttgctttttgtc-aaaatccctggctttattttaggcgccagtttgaattttgaaaatctaagggaatccctgctatgtcaga |
34678547 |
T |
 |
| Q |
235 |
aaaaaccgacggaaaaagccagggaactgcccctcggtttgagaaaaccaaaggaatccctgcgttttcccagctgagttgacaagggcctgccaaaagc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||| ||| ||||||| || | |||| ||||||||||||||||||||||||| |
|
|
| T |
34678546 |
gaaaaccgacggaaaaagccagggaactgcccctcggtttttgaaattcaagggattccctgctttgttccagttgagttgacaagggcctgccaaaagt |
34678447 |
T |
 |
| Q |
335 |
tgagcgttgccggcctgccaggggcg |
360 |
Q |
| |
|
|| ||| || ||||||||||||||| |
|
|
| T |
34678446 |
tgtccgtcgcaggcctgccaggggcg |
34678421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 36 - 169
Target Start/End: Complemental strand, 20339024 - 20338892
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| ||||||||||| |||||||| |||||||||||||||||| ||||||| ||| | ||||| ||| |
|
|
| T |
20339024 |
cactacaagaataatgaccttttgccagggattttgtcaagggtttgacacccctggaaaatttgccagggaaaatgccaaggagaactgctggcataaa |
20338925 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaa |
169 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||| |
|
|
| T |
20338924 |
agacagggagttgcccctcg-tttttgtcaaaaa |
20338892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 39 - 169
Target Start/End: Complemental strand, 49329602 - 49329473
Alignment:
| Q |
39 |
tacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaaga |
138 |
Q |
| |
|
||||| ||||||||| ||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||| ||| | ||||| |||||| |
|
|
| T |
49329602 |
tacaaaaataatgactttttgccagggattttgtcaatggtttgaaacccctggcaaatttgccagggaaaatgccaaggagaactgctggcataaaaga |
49329503 |
T |
 |
| Q |
139 |
cagggatttgcccctcgctttttgacaaaaa |
169 |
Q |
| |
|
|||||| ||||||| || |||||| |||||| |
|
|
| T |
49329502 |
cagggagttgccccacg-tttttgtcaaaaa |
49329473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 36 - 119
Target Start/End: Complemental strand, 2399664 - 2399581
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaagga |
119 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2399664 |
cactacaagaaatatgacattttgccagggattttgacaagggtttggtacccctggcaaatttgccagggaaaatgccaagga |
2399581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 83 - 124
Target Start/End: Original strand, 25259510 - 25259551
Alignment:
| Q |
83 |
aaacccctggcaaatttgccagggaaaataccaaggaaaacc |
124 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
25259510 |
aaacccctggcaaatttgccagagaaaatgccaaggaaaacc |
25259551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 36 - 271
Target Start/End: Original strand, 4968258 - 4968494
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||| ||||| || || ||| |
|
|
| T |
4968258 |
cactacaagaataatgaccttttgccagggattttgtcaagggtttgaaacccctcgcaaatttgccagggaaaatgccaaggagaaccgctgacataaa |
4968357 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttgacaaaaatccctcggttttgataaggcgccagtttgaaatttgaaaatctgagggaatctgtgct-tgtcag |
233 |
Q |
| |
|
||||| ||| ||||||||||| |||||| |||| |||| | ||| | | |||||||||||| ||| || |||| |||| ||||||| |||| |||||| |
|
|
| T |
4968358 |
agacatggattttgcccctcgttttttg-taaaatgccctggttttagtttaggcgccagtttaaaaattcaaaagctgaaggaatctctgctgtgtcag |
4968456 |
T |
 |
| Q |
234 |
caaaaaccgacggaaaaagccagggaactgcccctcgg |
271 |
Q |
| |
|
||||||||||| | |||||||| |||||||||| |
|
|
| T |
4968457 |
agaaaaccgacggcttatgccagggatgtgcccctcgg |
4968494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Complemental strand, 13338178 - 13338033
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
13338178 |
cactacaagaatagttaccttttgccaaggattttgacaagggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaaaa |
13338079 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
13338078 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
13338033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Original strand, 28902826 - 28902971
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
28902826 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgtcagggaaaatgccaaggacaaccgctggcaaaaa |
28902925 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
28902926 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
28902971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 60 - 168
Target Start/End: Complemental strand, 4449274 - 4449166
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctt |
158 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||||| |||||| ||||||||||| || |
|
|
| T |
4449274 |
ccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaagccagggactttgcccctcgttt |
4449176 |
T |
 |
| Q |
159 |
tttgacaaaa |
168 |
Q |
| |
|
|||| ||||| |
|
|
| T |
4449175 |
tttgtcaaaa |
4449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 60 - 162
Target Start/End: Original strand, 13507567 - 13507669
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctt |
158 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||||| |||||| ||||||||||| || |
|
|
| T |
13507567 |
ccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaagccagggactttgcccctcgttt |
13507665 |
T |
 |
| Q |
159 |
tttg |
162 |
Q |
| |
|
|||| |
|
|
| T |
13507666 |
tttg |
13507669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 36 - 119
Target Start/End: Original strand, 31519894 - 31519977
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaagga |
119 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31519894 |
cactacaagaaatatgacattttgccagggattttgacaggggtttggaacccctggcaaatttgccagggaaaatgccaagga |
31519977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 36 - 119
Target Start/End: Complemental strand, 17311518 - 17311435
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaagga |
119 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||| ||||||| ||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
17311518 |
cactacaagaaatatgacattttgccagggattttgacaggggtttggaacccctgggaaatttgccagggaaaatgccaagga |
17311435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 36 - 95
Target Start/End: Original strand, 28679082 - 28679140
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaa |
95 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
28679082 |
cactacaagaataatggccttttgccagggattttgtcaa-ggtttgaaacccctggcaa |
28679140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 106
Target Start/End: Original strand, 20106166 - 20106236
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccaggg |
106 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||| |||||| |||||||||| ||||||||||||| |
|
|
| T |
20106166 |
cactacaagaaatatgacatattgccagggattttgacaggggttttaaacccctgggaaatttgccaggg |
20106236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0260 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: scaffold0260
Description:
Target: scaffold0260; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 36 - 169
Target Start/End: Complemental strand, 1347 - 1215
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||| ||||||||||| |||||||| |||||||||||||||||| ||||||| ||| | ||||| ||| |
|
|
| T |
1347 |
cactacaagaataatgaccttttgccagggattttgtcaagggtttgacacccctggaaaatttgccagggaaaatgccaaggagaactgctggcataaa |
1248 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaa |
169 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||| |
|
|
| T |
1247 |
agacagggagttgcccctcg-tttttgtcaaaaa |
1215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0214 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: scaffold0214
Description:
Target: scaffold0214; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 36 - 162
Target Start/End: Complemental strand, 456 - 330
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||| |
|
|
| T |
456 |
cactacaagaataatggccttttgccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaa |
358 |
T |
 |
| Q |
136 |
agacaggga-tttgcccctcgctttttg |
162 |
Q |
| |
|
||||||||| ||||||||||| |||||| |
|
|
| T |
357 |
agacagggactttgcccctcgttttttg |
330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0573 (Bit Score: 70; Significance: 2e-31; HSPs: 1)
Name: scaffold0573
Description:
Target: scaffold0573; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 36 - 181
Target Start/End: Complemental strand, 6968 - 6823
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaa |
135 |
Q |
| |
|
||||||||||||| | ||| ||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||| ||||| ||||| ||| |
|
|
| T |
6968 |
cactacaagaatagttaccttttgccagggattttgacaagggtttgaagcccctggcaaatttgtcagggaaaatgccaaggacaaccgctggcaaaaa |
6869 |
T |
 |
| Q |
136 |
agacagggatttgcccctcgctttttgacaaaaatccctcggtttt |
181 |
Q |
| |
|
| || ||| ||||||||||| || || |||||||||| |||||| |
|
|
| T |
6868 |
acactggggtttgcccctcgtttattttaaaaaatccctgggtttt |
6823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1414 (Bit Score: 63; Significance: 3e-27; HSPs: 1)
Name: scaffold1414
Description:
Target: scaffold1414; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 30 - 162
Target Start/End: Original strand, 1155 - 1290
Alignment:
| Q |
30 |
atatagcactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggca---aatttgccagggaaaataccaaggaaaaccgg |
126 |
Q |
| |
|
|||| ||||||||||||||||| || ||| |||||||||||| ||||| |||||||||||||||| ||||||||||||||||| ||| ||| ||||| |
|
|
| T |
1155 |
atatcgcactacaagaataatggccttttgccagggattttgtcaagg-tttgaaacccctggcagcaaatttgccagggaaaatgccagggacaaccgc |
1253 |
T |
 |
| Q |
127 |
tggcacaaaagacaggga-tttgcccctcgctttttg |
162 |
Q |
| |
|
||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
1254 |
tggcaaaaaagacagggactttgcccctcgttttttg |
1290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 7e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 67 - 181
Target Start/End: Complemental strand, 2063664 - 2063550
Alignment:
| Q |
67 |
ttttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaagacagggatttgcccctcgctttttgacaa |
166 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| ||||| |||| || ||| ||||||||||| || || || |
|
|
| T |
2063664 |
ttttgacaagggtttgaagcccctggcaaatttgccagggaaaatgccaaggacaaccgctggcaaaaaacactggggtttgcccctcgtttattttaaa |
2063565 |
T |
 |
| Q |
167 |
aaatccctcggtttt |
181 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
2063564 |
aaatccctgggtttt |
2063550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 60 - 162
Target Start/End: Complemental strand, 33891961 - 33891859
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaaggaaaaccggtggcacaaaagacaggga-tttgcccctcgctt |
158 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||| ||||| |||||| ||||||||||| || |
|
|
| T |
33891961 |
ccagggattttgtcaagg-tttgaaacccctggcaaatttgccagggaaaatgccagggacaaccgctggcaaaaaagccagggactttgcccctcgttt |
33891863 |
T |
 |
| Q |
159 |
tttg |
162 |
Q |
| |
|
|||| |
|
|
| T |
33891862 |
tttg |
33891859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 37574946 - 37574900
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctggcaaatttgccaggga |
107 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37574946 |
ccagggattttgtcaagg-tttgaaacccctggcaaatttgccaggga |
37574900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1371 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold1371
Description:
Target: scaffold1371; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 36 - 117
Target Start/End: Complemental strand, 1899 - 1818
Alignment:
| Q |
36 |
cactacaagaataatgaccctttaccagggattttgacaagggtttgaaacccctggcaaatttgccagggaaaataccaag |
117 |
Q |
| |
|
||||||||||| |||| || ||| | ||||||||||||| |||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
1899 |
cactacaagaaaaatgcccatttgctagggattttgacaggggtaaaaaacccctggcaaatttaccagggaaaatgccaag |
1818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 60 - 92
Target Start/End: Complemental strand, 167648 - 167616
Alignment:
| Q |
60 |
ccagggattttgacaagggtttgaaacccctgg |
92 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
167648 |
ccagggattttgacaggggtttgaaacccctgg |
167616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University