View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5005-Insertion-7 (Length: 305)
Name: NF5005-Insertion-7
Description: NF5005
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5005-Insertion-7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 22 - 217
Target Start/End: Original strand, 17322378 - 17322574
Alignment:
| Q |
22 |
gatgacgagaattgttcttctctcttttggtttat-ttgtttcccttaaaaatgtttaatgtgaattaactgacgtaagcataaaagtaaagggggacga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||| |||||||||| ||||| ||| ||| ||| ||||||| |||||||| | |||||| |
|
|
| T |
17322378 |
gatgacgagaattgttcttctctcttttgattttgcttgttctccttaaaaatatttaagatgagttagttgatgtaagcacaaaagtaaggcaggacga |
17322477 |
T |
 |
| Q |
121 |
gcaaaatcaaacgggagaagatcaattctccacgaagacaccacttagaatttcaaagcaaaggttaactttgtttttgactcataacaaaagttaa |
217 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
17322478 |
gtaaaatcaaacgggagaagatcaattctccacgaagacaccacttagaatttcaaagcaaaggttaattttgttttcgactcataacaaaagttaa |
17322574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University